Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Supplier:  Thermo Scientific™ SO118

Catalog No. FERSO118

Description

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'

Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

Specifications

• Promoter: SP6, T3, T7
• Content And Storage: T7 promoter Sequencing Primer, 20-mer, 10 μM
  
  Store at –20°C.
• Concentration: 10 μM
• Vector: pTZ19R, pTZ57R, pBluescript II
• Form: Liquid

• Product Type: Sequencing Primer
• Shipping Condition: Dry Ice
• Primer: T7
• For Use With (Application): Sequencing

For Research Use Only. Not for use in diagnostic procedures.